CBrugiaQ_1353


Sequence

>CBrugiaQ_1353 (5 EST) Length=424 TTGGNGCNGCTGCTCAAGAACGGTTTAATTACCCCAGTTAGAGATTTCTTCTTTTTTACTTGGCATCATCAATGGCAGCA CCAACAGAACGATTTCATGTGTTATCACAGCTTGATCATTTGCAGTCAAAATATACAGGTACTGGACATGCCGATACAAC GAGATGGGAATGGCTCGTTAATCAGCATCGTGACACATATGCATCAATGATCGGTCATCCAGACCATTTAAGTTTGATAG CAGTATGCGAAAACGAATCGCGAGCTAGGGTTCGGTTCAATCTATTGAATCAAATGATTGCGCCTTGTGGACCACCACCT GAAAAGTCTCCACTTGATGAATGATTTCCTTATAGTTTCATTAACTCTCTAATATCTCTGGAATTGTGTACTGTTGATGC GATGGATAAAAGTCTGAGTAGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_1353: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4446351167436N43134SWMFCA329SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4450371172419N43536SW3ICA888SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10481552064802AA406823MBAFCZ4H09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12139462335028AA563563SWMFCA2548SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12652022402573AA588910KJ4SLB352T3JHU93SL-BmL4 (JHU)


Date: 22:35:34 on Tue 21 Nov 117.