CBrugiaQ_1359


Sequence

>CBrugiaQ_1359 (17 EST) Length=913 AACTTATAGTCCAGTTGACCTTCTTTCACGACCATCTTCCCAGCAACACACTTTTACCAATTTCTTACCAAATCCACTTC ATCACTTTTCTTTAATTCTAACATTTTACCTTTGCTTAAATTGTCCCTTCTTCAATTAAAATTAAATTACATCATATTTT AATTTTGTAAAATTGTAAAGAAATTAAAAGTATATAAACTATTAGCAGCAAATATAATCATTCCTATTTCGAAAAATAAA TTATTTCATTTATTTGAACGCTTAATTAATCTCAAAAAGCAAAAAAACTAATTAATTATACAATTTTAACATTAAAACAC AATGCCGAATTCAGCATGAGATTTCAATTCATTACCGTCACAAAGAAACAATTTAAATTAATTCATCAATGGCATACATA CTGCTACTCATCTTTCTCTCACTTCATTTCACCTCAGCGCAATTGACCAGTGATCCAGGACTAGCATTTGAAGTGATCGG TGCTGAAGCGCAAGATGATAAGGTGAATGTTACGGAATACAATGATCAAAAGGTGACAACAAACGATCAACCAAATGTGG CACATCAACATGATCATCATGGTGACGATGATGAACTGACCAAAGAGCATGCAAAAAGTGAGCCAAAATTACTGAGAGTA CGAGCAACTGTTGAAGATGAACAAACACGTCAAAATGAAACGGAAACTGCTGAGCATCATCCGAAAGAGATTAAACTGCA CAAGGAAGATAAACCGGAAACAACAACTGCAACCGAAACTGTTACCACAAAATTGCCATAAAAATGGAAATGAAAAATGG CATTTATCGACAGCAAAACAATTTCATCAATTTTATAATCACAATATCATATCAGCTCTATCCTAATTATTCCCTTTTTT TTTTTTTTTTTTACCNNAAAATAATTAATTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1359: (17 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7522741668258AA114427MBAFCE3C10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7522831668267AA114384MBAFCE3E05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7566611673286AA118237MBAFCE6H05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7566631673288AA118239MBAFCE6H09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7619941681862AA123551MBAFCE7G01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8985471893152AA257675MBAFCZ2G4T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8986241893229AA257726MBAFCZ3F5T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480282064675AA406683MBAFCZ2G04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11160422199183AA471419MBAFCX2C11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11536412246855AA508978MBAFCW1H02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11536692246883AA509006MBAFCX6B06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11538952247109AA509232MBAFCX8H04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11539612247175AA509298MBAFCX9F08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13247502539393AA627006MBAFCW2D07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13247512539394AA627007MBAFCW2D09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13668582605396AA661352MBAFCW3A03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13813252655445AA675739MBAFCW4B12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 23:6:8 on Mon 20 Nov 117.