CBrugiaQ_1363


Sequence

>CBrugiaQ_1363 (4 EST) Length=753 ACNGGATCGATAGGCNACGCTTTCGCGGTCTGTATTCGTACTGGAAATCAAGATCAAGCGAGCTTTTGCCCTTTTACTCT ACGAGAGGTTTCCGTCCTCTCTGAGCTAGCCTTAGGACACCTGCGTTACGTTTTGACAGATGTTACCGACCAAGTCAAAC TCAACGACTGACACTGTCTTCNGGTGCGAGTCGTTAAATCACCGAGTGATTTAACTTAAATCAAAAATTTCGAAATACAT ATAATATTTCAATTCTCGTTTGACCGAATAAGCTAAAGAATCGATGAAAGTAGTGGTATTTCACTGTTGGTATTTGTATT AATAAATACCAAAAAAAACCCTCCCACTTATGCTACCACCTCTCATGACTCTTCACAGAGTCGGACTAGAGTCAAGCTCA ACAGGGTCTTCTTTCCCCGCTGTGTTTGCCAAGCCCGTTCCCTTGGCTGTGGTTCGCTAGATAGTAGATAGGGACAGTGG GAATCTCGTTAATCCATTCATGCGCGTCACGAATTAGATGACGAGGCATTTGGCTACCTTAAGAGAGTCATAGTTACTCC CGCCGTTTACCGCGCTTGGTTGAATTTCTTCACTTTTACATTCAGAGCACTGGGCAGAAATCAGAGACAGTCAACGCCCG CAAGGGCCATCTGTCTCCTCTGTTTTAATTAGACAGTCGGATTCCCGAGTCCGTGCCAGTTCTAAGTTGACTGTTTAACG CCGGCCGAAATATCANATAAAACATTTACTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_1363: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3658201019993H64232RRAMCA041SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
4448481167745N43347SWMFCA159SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
5800731382074W59860SWAMCA730SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6462821502112AA032140RRAMCA282SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 14:22:7 on Fri 17 Nov 117.