CBrugiaQ_1367


Sequence

>CBrugiaQ_1367 (3 EST) Length=791 TTTCCTTGCATAATGGAAGGTTTTTCGGAACGTCTCTTGGAAATACTAAATGATGGGATGCTCTCTATTGGACTTGTCAT GGGTCATAAGCTTCAACTGTTCGATACCCTTGCTGCTGTATCATCGGAGAATGAACCAGCCACTTGTACAATGGTAGCTG AAAAAGCCGATATGAAGGAACGTTATGTACGCGAATGGTTATGTCTCATGGTCTGTGGTAAGATTATAGAGGTGGATGAG AGTGGCGAAAAATTTTGGATCAGAGAGGAACGCATTGGAGATCTCTGTGGTGATGAACCGAATACATTGCTTGCCATCCA GCAATCTGTTCTTATATTTGCCAAGGCATACCCTGCTGTCATCGAGCTCTTCAAGAAAGATGTGCCACTAGGGATAGACA ATAAAATGTTTGATGAATTTGATAAAACGATGGCATCAGTTTCAGAAGCTGCAGATAAAAAAAATATTATTAGCAAATTT GTACCTGTGACAGGGATGCAGAACAAGTTGGAAGAAGGTGGAATTCATGTTCTCCATGTAGGTTGTGGTCGAGGAATGCA TATTGCAGAATTAGGGAGTCATTACCCAAAATGCTTTTTCACTGGAATTGATACGTCACTCGAAGCTGTTATTGGAGCAA ACAAGAAAAAAAATGAAGCTAATGCTGGCCTCGATAATGTATCGTACATGCAAATAAATAGTCAGATGATGAAAAATGAG TGGACGGAGAAATTTGATTGGGTGATGATGTTCGGCGCTTGCCATAACCAAATGAGACCTGATCGCTGCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1367: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10481372064784AA406792MBAFCZ4G01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13814622655582AA675876MBAFCW5H01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13946082675713AA688431SWAMCA3098SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 13:48:39 on Thu 23 Nov 117.