CBrugiaQ_137


Sequence

>CBrugiaQ_137 (16 EST) Length=719 GGCCGGCAAGGAGGACTATAGTAATCGAGGCTATCTTCTGTCACTTCATCACTCAATCTAACAAAAATGAAATATTTTAT TTTCCTTTCAATCGGTCTGATAGCAGCAGCATCAGCTCAAAGAGAAGCACAATTACCTCAGCCAGAAATACCTCCATTTT TGTCCGGTGCACCCAGCCATGTTGTGAAGCAATTTTTTGATCTACTCAAAGCTGATGAATCAAAAACTGACCCGCAGACT GAAGCAGATATCGAAGCATTCATTCGCAGACTTGGTGGCGATTACCAAACTCGATTTGAGCAATTCAAGCAAGAGATAAA GAAAGAAAAAGCTCAGTATGAGAAAATCCATCAAGCAGCATTATTAAAATTTTCACCAGCAGCAAGAGAAGCTGATGCCA AGATGTCTGCTATTGCCGACAGTACGCAACTGACCAATCACCAGAAAACGGAACAGATCAAAGCAATTATGGATTCATTA AGCGAAGCTGTTCCGAAAGGAAATCTTGGAAGGATTTAATTCACAATAAAGTGTTATATCAGTGCTGCTGAGTATTTACA ATTAAGATTTTTTCAAAATGAAAGAAGAATCATNTNTGCGACAAAAGGTTATTAATTNGATAAGAAAAANTNTTGTTGTT CATCAATGTTGGAATATTTCAAGCTAATTTAATTATTACCCTCCGTTTAACCTTGGTTAATTCCATTTTAACCCCCATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_137: (16 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217602808424R47537SW3ICA100SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
354101992875H52879SW3ICA422SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
3658191019992H64231RRAMCA039SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
3795611054527H77276SW3ICA493SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4450891182116N43651SW3ICA821SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5304371300187W23333SW3ICA1466SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7061951592613AA072488SW3ICA1634SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7272471634892AA089413SW3ICA1780SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7272541634899AA089420SW3ICA1790SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7472711660881AA109411MBAFCE1F10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7621031681971AA123676SW3ICA1904SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8981241892729AA257201SWMFCA1492SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10774682125772AA433174RRAMCA1619SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10777472130930AA433453SW3ICA2341SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
13668712605409AA661365MBAFCW3B08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13870812663021AA681016SW3D9CA550SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 2:34:40 on Fri 24 Nov 117.