CBrugiaQ_1376


Sequence

>CBrugiaQ_1376 (9 EST) Length=499 GACCGCTTGAAGCTGTCGAAAGTTCACAGCTTTTGTTTTTCCAGCTTCTCGCTCATCCAATTTTTCACCACAACAAAAGA TTGTTTGTAGACCACTGTCGACTGCATGCAAAACTTTTTCCGCAATTAGCTCATCCGATTCACCAAAAATATGACGTCGT TCGGAATGTCCCAAAATAACCCAATGCAGTCCTAAATCTTTGATCATTGCTGGAGAAATTTCACCAGTAAATGCACCTTT TTCAACCTTATAGCAATTTTGTGCTGATACTTCAATGCCATTCTTAACTTTCTCCTTAACATATGATAAATAAGGTGCAG GTGGTGCAACGACAACATCCACATTTGGTACCACGGCTCCATCATTCAAAAATTTGATAATATTATCAACACTGGCCTTA TTGCCATTCATTTTCCAATTTCCACCAACAAGAAATTTTCGCGACATTGTAAATCTCNNNCTAGTACAGGCACGAGCCCA TTCAGGTGCACAAGTCGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1376: (9 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217596808418R47531SW3ICA032SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4445551167356N43054SW3ICA1050SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4447781167675N43293SW3ICA763SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4452121182239N43711SW3ICA745SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9141551912525AA273151SW3ICA2576SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9141751912545AA273171SW3ICA2599SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9214551923306AA280445SW3ICA2605SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10481602064807AA406828MBAFCZ5F03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11539362247150AA509273MBAFCX9D02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 8:17:23 on Thu 23 Nov 117.