CBrugiaQ_1383


Sequence

>CBrugiaQ_1383 (3 EST) Length=469 AGTAGCATATGCTTTTTCTTTCCATTCATCCATATCGGCGCATTTTGTTTCACTTACAACTTCACGAATTTTTTTTGTTG GTGTTGGTGTTCCATCAGGCAGTTTGTACATAATATAACAAAAAATTCGATCAGCTTCAGCCACTCTTTCATCAAGAAAT TTCAAAGCAAAATGTTTACGCCCTGCACGCTCTTTTTCAAGATCGCTCGACTCAAGTTGTTGCTTGTAAAGATTGTATGC GACACCTATCAGTTGAACAGGACTTGAAGTTCCAACTGCTCCAACACCAACTTCAACACATCGATCAATTAAGCCATCAT CAATTCGTTCACTTTCATTTGCTAATGACTGACGAACCTCACGTTTTATGATACTTAAGCGACATTTCAAAGATGGCGGA AAAACAAAATGGTTAAGCTGTCGCATTTCAAAATTAAATCGTCCGGAAACTGACGACACCTCAAACTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1383: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7522681668252AA114421MBAFCE3B07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11162752199416AA471652MBAFCX5A08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11536102246824AA508947MBAFCW1E06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 10:43:23 on Tue 21 Nov 117.