CBrugiaQ_1392


Sequence

>CBrugiaQ_1392 (2 EST) Length=643 TCGGGATAATCCTGAGTTTGTAGCAGTTGAGCGTCCAAAGCCCATATCAGTAACCAATTCAACAACCATCTGAATGTTCC ATTTAGAAGTGTCATATACAATTCGCCCCTGAGATTTATTAAGTGAAACGGAAATTGATTTTATGCCGTCGTTTCTTCCA ATAGTCTCCTCGATATTATTTACGCATGAATGACATGTCATCCCTTTGATTTCAATTATTGCTTCATGAAATTTCGAGGT TATTGGATTCTTATTCAAATATTTTTCATTATCTTTTTTGTGATCGTTTGACAAATTTGTTTGACAGATTTCTTCCACTT CACAAACTTTATCCTGAATATTATTCGCTGATGAATGAGATGACATTCCTTCAGCATCAGTTATCACAACTCCTTTATCT GTTTGCTGACTTAAAAAATTAAATAATTTCACTCGTGCCGAATTCGGCACGAGCGTTTGAAGAATTATGCAGGTTGGGAG CATTTATCAGAACCACTTCATCTACTAGTACGCGCAAATGATTCAACCATTACACTGTGCGCCATGAAGCTTGCAGATGG CGTGCAACATATAAAGCAATATCTTAACGAAGAAGTAATCTATCGATAATTATTAACTACAATAAAATAAAAATAAAAAT TGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1392: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5362461309126W29142RRAMCA1330SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10751552113632AA430836RRAMCA1565SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 16:8:45 on Fri 17 Nov 117.