CBrugiaQ_1393


Sequence

>CBrugiaQ_1393 (4 EST) Length=587 TGATTTAATTATCAACGATGGTGATATTCTCACTGACGTATATCCCATCTAGAAATTCGCGAATATCCTTATTCTTCACT GTTGTTGATTGCTGAATACGTGCCGCTGCTTGCGAAACAAGTTGCAAGTCATTGCCATATACGATCAATTCATCTTTCTG GGTGGCCGACATGGTTGCTGTAACACCATCTGGCAGAGGCACACGCCTTGTATATTTTTCTCCCAAAAAGTTTCGAATCT CAACGATAGTATTCTTTTCCTGAAGTGAGATATTGATGGGGAAATGAGCATACACCGACCGCATCTTATATCGGAATCCT TTAGTAACACCTTTAATCATATTTTCAATGTGAGAACAAACGGTACGAATAGCAGCGACTTCTTTCCGTATTCCAAACCA TTTCCTCACACGGATTGTATTGTCGCTAATCTTTTCGATCTCCATATGCAAGTGTCGAAAATCCCTCCTCAGTACACCAC GAGGTCCCTTGACAATGACCACTCGTTTGTTAACTGAGAATGTTACACCCTCCGGGAACTTTACTGTGTCATGTGCCTCG ATGAGCTTCATCCTTTATCACTCAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1393: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8811031871087AA241423MBL2SJ9E12T3Brugia malayi second stage larvae JHU96SL-BmL2
11535932246807AA508930MBAFCW1C12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11536142246828AA508951MBAFCW1E10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11536552246869AA508992MBAFCX6A04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 19:42:13 on Fri 17 Nov 117.