CBrugiaQ_1399


Sequence

>CBrugiaQ_1399 (2 EST) Length=454 AGAAAAAGAAGTTTCATTCAACTGGCAGAAATGTTTTGGTGTCTTGACCAGTAGCTATACTCATGTTGTCGATTTTCCGG TAAACTTTTGTGTTAATGAATGCTAAATTACGCGTTGTCTTTCGGACGGTTGACTCGGCAATGATCGTTTCACCAGGCTT TGCTACACTCTGATACGAAATGGATAAATCCACAGAACGGCCACCTGTCGGTCTACCGGAAGCGAGAACAGCCGCAGTGG AAACAATGTTGACCAATGTTGCAGTAAAGCCACCGTGTATTGTGCCGGATGGATTAAGATGTTCATCAGCTACCTTCAAC TCAATTTCGACATGTCCGTCTTCAGTAGCTTTGTTTATCACACAATTCCGTACGCAATACGCGAAATCCTTCGTTCCTTC GAAATCACGAAACATCTTTTTTAGATAGATTAAACTTTTGTTAGCCATATTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1399: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4450731182100N43635SW3ICA794SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
11887372289601AA542689MB4SLY2B06T3Brugia malayi L4 JHU93SL-BmL4


Date: 22:53:52 on Wed 22 Nov 117.