CBrugiaQ_1410


Sequence

>CBrugiaQ_1410 (3 EST) Length=455 AGGAAAGTTGTTGACATTGGAGTTGATATGTGGAAGAATGTTCAGGGGAGNAATTTGATAGATAAATTCATATGAAGAAG AAAAGAATACGTCGAAAAGCTGAAAGAGAGTTTAGATTAGCATGTACTGGTGACACATTCGTTGCTATCACTGTCACCAC TGTCACCGCTGTCACCATTGCAACCACTGTCACCATTGTCACCATTGTCACCACATCTAGCCTCGGAAGAAGCAGTACCA AAGTGCGTGCAGCACTGCCGGCAACCCANAGAAGAAACACAGAACGATATTCACTACCACATGGATATTGCAATCGCTGC TATGGATGAAAATTGCCAATGGCGGCCACAAAATTGCTAAGATAAGTTCGATAATCTGTTGCACATCCACCATAANTGCT GTTTTGTTCGTTTATTGTTTATTGTTTATTGTTTANAAATCACAATAATGAATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1410: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281192889949H21254AS3ISB177SLBrugia malayi infective L3 JHU93SL-BmL3
4156251122569H98347SW3ICA498SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4427281164876N41278SW3ICA1005SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 10:10:30 on Fri 24 Nov 117.