CBrugiaQ_142


Sequence

>CBrugiaQ_142 (15 EST) Length=727 ACTGATTCAGATTTTACGCCTTAAACTTTATGAATAATATAACAGTATCCAGTTAAAAACAAACTGACAGAATTAAGAAC GCTTGTAGGAATTGGAACAACATTTTTAGTTTCGGTATCCACGAGACTTTCTAACGTCCACGAGTTCTTTCAAATTGGCG TCCTTTAGAACGAACAAGTGGTTTGGTATGACTGTGAGGTACACCTGGTGCTGGACCGAAATGTCTTTCAGCTAAGCGGT GTTTTCGCGGTCCTTGCAAAAGGAAGGTATTTTCTCCACGTGGTGCACGCAAAGCGAGTTGGTCGAGTGTAATTATTTCA CCACCTGCTTTAATTATCCGTGCGCGAGCTCCTTTAGTCACATGCAGTGCAGCAACCGTAAGCTTGGGAATTTCAAAAAT CCGATTATCATCTGTGATCGTCCCAACTACGACCGCTATTTTCGTTATATTACCACCTCTTTTCATGTAACGTACCAAAC GAGCAAGTGACATCGGTGGACGATGGCGACGAGCCATCATTAATCTTTTCGTGATAATATTGTTGAATTTTTCACCGGTT TTCCGAGTCAAGTATTTGTATAACTTTACTAGGACTCGAAGATACGGATCTTCACTTTTTGGTGCTTTACGCCGTACTTT ACGGTCATTTTTATGATTTATATCGATACCCATTTTTAATACTGGACTGCTCCCCCTCGCTAATCCTGCACTCAAANTCG GCACGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_142: (15 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
296616905420H35916SWAMCA191SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
4459791182996N44477SWMFCA200SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6722411537188AA052010SWMFCA714SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6837831550542AA057902SWMFCA898SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7472571660867AA109397MBAFCE1E04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9100091906074AA269006SWMFCA1790SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9214731923324AA280463SWMFCA2006SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10481272064774AA406717MBAFCZ4F01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10751182113595AA430773RRAMCA1515SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11161252199266AA471502MBAFCX3C03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11253762209444AA480746SWMFCA2118SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11536232246837AA508960MBAFCW1F07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11537672246981AA509104MBAFCX7C12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11588152252992AA514175SWMFCA2295SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12139352335017AA563552SWMFCA2533SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 1:58:10 on Sat 18 Nov 117.