CBrugiaQ_1420


Sequence

>CBrugiaQ_1420 (4 EST) Length=494 GTTGGTTTCGATGAACCGTCGTCTCTCTTCAAATTATTGCACAACCGTTTGTCAAAAAAGTGGCGTGGAAGTTCTGCGTG ATTTCAGTTGGAGCGCTAAATTGGTTGGTGATTGTGATACAGCACTCGGGAATCTCAGACCTATAGTTGTGCTTACGTTA CATTTTATTGAAGGTGCCACCAGAACATACGAATTTACTGTGGAAGAATTGANGCGCTTTATTGGCGATTTGGAAGAAAT CCTGCAGAAATTTAATTAGAAAATGTATCCAAAATTATCACCGGGATATATTACGAAGTCAACCGCCATTATCCTGTCAT CTTCCACGTTTCTGTATGGATTTATGGAGTATATCACAGGAAATGAAGTCTTTCAGCGGAAGCAAGTAAATATTTTCTGA ATCTAAAATTCTGATAAAATTTCCAGAAATTTTAAAAGTTGTGAAATTTGGGATGTTTGGGTTAATAAAATCTTTTAACT TGACACACAACACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1420: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
235567828888R58830AS3ISB262SLBrugia malayi infective L3 JHU93SL-BmL3
8982061892811AA257309MB4SLM1E3T3Brugia malayi L4 JHU93SL-BmL4
8982071892812AA257310MB4SLM1E4T3Brugia malayi L4 JHU93SL-BmL4
13668952605433AA661389MBAFCW3D12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:31:22 on Mon 20 Nov 117.