CBrugiaQ_1424


Sequence

>CBrugiaQ_1424 (4 EST) Length=646 GGAATCATTTTTTCTCATTTCTTATTTATTTATGAGTTGGATTGATTGGTGCTGTGAATGCTTCCACTGTCATCGGTCGA TTCCATTTGAAATTCATTTATTGGCAAATCTTGAACCATCGTCCATTGTTAAAGCGCCAGCACCTAAACCAAAGCCAACA CCTTTTGGGCCAAACTTTCGACCGTGACATTGTTTACAGTATAGTTCAGCTTCATGTGGTGCTACATTTGTTGAATCCAA CAATTTGTTACACAGTTCACATTTGAAACAAAATTTATGCCATTTGTAACCACCAGCATTCATTTCCTCTGCAGCATACA CTGATTTACCGCATTTTGGACATTTTGGATGTTCCACCGGTTTAAATGGCATTTTGTTTGTTTGTTTGTTTGTTTGTTTG TTTATTGTTTCACTCTATTTTAGCCTCAAACTCGTGCCGAATTCGGCACGAGGTTCGATTTGTCGCAAATATTCATATGA AGATCTGGCAACTTTTATATTTTGGAAAGCTCATGCATTCCCAGTAGTGCACGAATGAATATCTTCTATCGTTTTCAAGA AATACTTTTTATTTATTCTCATTTTTCGTGTTTTCTTTATGTATTTGGACATCAATTCTTGCTTCTCGATAAATGTGTTC GTTCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1424: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217704808526R47639AS3ISB040SLBrugia malayi infective L3 JHU93SL-BmL3
8982861892891AA257252MB4SLM2F7T3Brugia malayi L4 JHU93SL-BmL4
11537092246923AA509046MBAFCX6F03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11538812247095AA509218MBAFCX8G01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 0:6:39 on Sun 19 Nov 117.