CBrugiaQ_143


Sequence

>CBrugiaQ_143 (3 EST) Length=844 AGATACNTCTGAGTAGTGTGNANGAGTTCCAAGGCAATGTATCACGTGTGCATTTGCCACGTTCAGTGTTTCAAGGTGAG CGTACCAGTAGATGAGTCGAATGTCTCATGTATTAGCATGTGAAGATGAGTCTGCTGCCAGCGGAACGCGTATCGTGTAT CATGCATCAACCAGTAATTGTTCNGACCAGTACTATCTCAGATTAGTCTTGTCCGAAAAACATTCAAAAAACCTGGCAAT GAAAGCTGCACAAGCTCAGTAAAGTGGCTGTGGCTTGGTCGAATCTCGAACGGAGACGAGAAACGTGGTAATTTCGGGAA CTGCCAACGCGTGGGGAAGATGTGTAGTATTGGACCCATTGGAAAGATGTAATAAGTGTAGAGTGTAAGCATTGTGCTAT TCCATTTGGACATGATTCATTATTTAGTTTGGGGACTGAATCATCGATAACATATGCGAGGTTCGACAGATTGAGACCAT CAGATTCTTGTAGTCTGGTGAAGTCACTCAAAGATGAAAACACAGCGATTTCTCGACTACTGGGTGTTTCAGTACTATTC GCATAATCTCGTATATTTCCGATGAAATCATTGATCATTGATAGTGCCACATATCCCTCTGATTTTGGTAGATATTTGAT TAATTCGCCAATACGATCCACATGGAAACCATCAACTCCCATGTCAATAAAACTTTTTGCAACCTCAAAGATACTTTTCT TTACCGCAGGATTACTCCAGTCTAGTATTGGGTCTTTCCCGTCATAAGATAGATAAGCATCCTTTTTGCCCTCTTCAACA ATATAATTTGGGTTATCTTTTACATCCAGTGCCTCNTTCCAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CBrugiaQ_143: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11539672247181AA509304MBAFCX9G02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11919502307192AA545901SWMFCA2455SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12774152429557AA598364SWMFCA2925SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 0:39:17 on Fri 24 Nov 117.