CBrugiaQ_1436


Sequence

>CBrugiaQ_1436 (19 EST) Length=652 TGACTAATCAAAGTGGTACGCAATTCAAAATCTGANTGTGTCGAACCTCCCGAACCGCTGTATGTAGACTGAAAAGCAGG GTTCATATATACAACCGGATTTTTCCTTCCAATCGGTGACAGAGAATCTGAGAAAGAGTGACTGCGTGAGCGCCGACGTC TTTTTTTGTGGGTTTTATGATGATGATGTTTTGGATGTCCATCATTTCGAGATGGAGAATCACGTTTAGAGCTATGGCGA TGACGATCAGAGCTTCGCTTATGATTAGATGATGTGCTATTTTCCATGGTATGCAAACTGTTCACTTGTAATTTCTTGTG TCAGATTGCAACAAATCTGGGGAAATATTTTTGGTCAGGAGTGACCAGAATTATTTATCGCCAATTACACAAATAGGAAC AGCACAACCCGCTGACTTCTTATGTTCCCTCGTGCCGAATTCGGCACTTTGTTTTTAAATATAATTATCTAATTTTTGTT TTGCTTGGTATTGAATTGTTGTTTTTTTCTTTACTTGTTTATTATATTTTTTTTTTAAATCCTATTGTTTTTTTTAATTT TTGGTGTTTGGGACTTATATCCGGGGTTGTTGGTTTAGTTATTTTTTTTTTAAGTTTAAAAATTTTGGGTGTGGAAAAGG TTATTTTTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CBrugiaQ_1436: (19 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217584808406R47519SW3ICA012SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
309262924263H48211SW3ICA308SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
320177944793R86387SW3ICA336SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4447541167651N43269SW3ICA705SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5220921289164W15124RRAMCA1250SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5441691318063W36317RRAMCA1247SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5441881318082W36336RRAMCA1379SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5800761382077W59863SWAMCA735SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7472251660835AA109365MBAFCE1B02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8001571737540AA161708MBAFCE9F05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9141291912499AA273125SW3ICA2102SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9141531912523AA273149SW3ICA2574SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9246651927235AA283577SW3ICA2731SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10614582078608AA417398RRAMCA1423SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10750542113531AA430761SWAMCA1768SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10987522167922AA454253RRAMCA329SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
13860362660398AA680450SWAMCA3025SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
13860382660400AA680452SWAMCA3029SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
13860392660401AA680453SWAMCA3030SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 20:12:21 on Sat 18 Nov 117.