CBrugiaQ_1439


Sequence

>CBrugiaQ_1439 (2 EST) Length=651 CATACAAAATAGCAAGCTCATACANAAATGAAACAATGAGAGATACAATATGTCAGTTGAAGTATTTGTTGATATAAAGA AATCGCACGACACTAAGAAGTGTCGTATGCTTTATTATGAGGCGTAAAAAGAATATGTTTCAGTGTATTGACACTGAAAA ACGATTCCGTAACAAAGAAACTTAATCCAATGCGGACCTATAACATTGAATGCAGAATGATTCTGCGTCTTTAATAATAC AAAAAAGATTTTACAAAATGCTTTAAAAGACTGGGTCATTAAAAAGTAATCAAAACATGGAAACATATGATAATATTTGA AATACATTAAGAGACACTATTTGAAAGCCTCGAACATGCATGTGCAACAGAGGAATGTTCCTTATTCAACTCGAGATCGA GAGATTGCAGTTTTAATCTTTCTTCGCTGTGCTACCTGTGCTAGTNAGTTCCCTTTCTTTTTTCCTGACCGCTAACACAA TAATTAACTATTTTCCTGGTATCACCTTCTGGATGCGAGTGCTTATGTTCATACTGTTCAGCCTTTGTTCTTTTACCAGC ACCTTTGCCAAATTTGTCAAGATTCGTTTCGCCTTTTTCAAATTCAGCTGCAAGCTTCTCGGCATTAGACATTTTCGTTN GTCTTCTGATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CBrugiaQ_1439: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217674808496R47609AS3ISA059SLBrugia malayi infective L3 JHU93SL-BmL3
10481332064780AA406788MBAFCZ4F08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 11:56:26 on Wed 22 Nov 117.