CBrugiaQ_144


Sequence

>CBrugiaQ_144 (4 EST) Length=616 AATAAANNTCATACATAACAGTTTTCCAAGGGAACTGTGCTAAAGAGTTGGGTAGGCAANTGCCTCATGTCCCAAAACCG TAAAGTTTTATCCCCAGGACCCGTTCATTAAACAAGCTGTAATGGGGAGCTTGGATCCCAGGACATTTCCTGACAGGTTC TTCGGGTGTTCCCCACGACGACCATCGGATTGGAAGGGAGATCCCAAATTCGTACTGGCTTATCTGCACTTGCAATAAAG ATTTTGGTGCCATCATCAAGCCAGTCAAGATCTAAAACTGGTCCTGTAACATTTTGTTGAGCTTTTGCTTCACACTGACC GCTTTCACTGATCTGCCATACACGAATCACTGAATCCCAACTACCCGAAACAAGCAAAACTGGCTGGCCAGCAATCTGCG GATTGAATTTCAGCGCTTCAACTGTGTCATCGGGTGGTGATGGTACTTCAATATCGTTCAGTGGATTCTGACTTGTATTG GCTGTGCCGGATGAAAATATGCTGTTCGGTCGTGAGCCAAACGCATTAGTAGTACCAAACATTAAGACAAACCAAAACCA GCAAGAACCTTCGAAACAGTCTTCTCTTCCCACAAAATTGTAGTATTACTCAAACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_144: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8675621849792AA228221SWMFCA1260SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8985601893165AA257688MBAFCZ2H5T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480412064688AA406696MBAFCZ2H05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12354772369572AA585019SWMFCA2854SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 19:13:49 on Wed 22 Nov 117.