CBrugiaQ_1440


Sequence

>CBrugiaQ_1440 (3 EST) Length=447 AAGAAAGTGGCTGTTCCCAGCAGGACTGGAAGCATCGTGTCATTTACATTGTACATCCCAATATGAAAGTAACACGAGAA ATACAAGTAAATGGTAAATCTATCGAGACAAAATATGCCGGAGAGTATATGTATATGTCCAGTGAAGGACAAGCTATGTT TATTAATTATGCTCCCGGTGGACAAACTTCTAACAACGATGATTTCTCAATTCATGCCTATCAAGTGCACACACCAACAG CTTATAATGGCGATGATTACTTGAGCAGACGATGGTCAGAAATTACCCGGAAACTTGCTCATTTTGCTCAAACTAATAGT AACGGAAATCGATGTTAATGATTAAATCGTTCATAACTTACCGAAAAATTAACTTTTTTAGTAAATAACTTACTGATCAT AATTATTCATTTGGGAAGCAATTGGTATAAATTATTATTAATTCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1440: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5014571266978N94697RRAMCA1169SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6462521502082AA032110SWAMCA1413SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10750602113537AA430780SWAMCA1787SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 14:16:13 on Mon 20 Nov 117.