CBrugiaQ_1443


Sequence

>CBrugiaQ_1443 (6 EST) Length=629 CATTAGGAGTACCACTGTTGTTGCTTTGATTNTGAAAACCAACCGCTTCAAATGTCTGGTTCGAGTCACTATCGAATCAT CCTTTTGAGAAACCAGTGTTAGAGTCGTCATTCAAATTACCAAAGACACGAACTCGTGTTACATCGCTATTCTCTAATGC AGTAGAGTCTTGAGTATTTTCCGACGACGCAATTGTTGTGCTTTCATCTTGATCTTGCACTATAGACTTCTGTGGTATTT TTGTAATATTCGCTGTTGCAGTTACCGGAACCCACCGAAACAACTTTATTTGAGTATCTTTAACGACAATCCATTTCTTT TCCCATTTCCGAACTTTATCTACCGAATTAATGACCCGTTTCAATTCATCTTTCGCACGATTACGCGTTTCTGCCCGCTG GCTGCGTGCATACATATGCAGTTGATTAAGTCACGACGTATCTCAAATTTGAATCGTGCCGAATTCGGCACGAGTTCAAA TCAAAATCTGTATTAATCACTTTTCTAATGAACTAAATAAATGAAACATTCCTTCAACAGAACCATGACTTAAATTACAA ATTTGCAACAGGAAACACGTCAACACTTTGTCAAAAAGGTATAAATAGGACAGAGCCAAAAGATATGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1443: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7566381673263AA118214MBAFCE6E08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8984141893019AA257517MBAFCZ1B9T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8986181893223AA257720MBAFCZ3E10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11161552199296AA471532MBAFCX3E12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11537522246966AA509089MBAFCX7B06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11537632246977AA509100MBAFCX7C06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 14:28:44 on Sun 19 Nov 117.