CBrugiaQ_1446


Sequence

>CBrugiaQ_1446 (3 EST) Length=472 CAGATAAGGTAAAGTGATGGTCTTGTAATCGTCCGGTGTNTCATAGATGACATATCGCTTCTGATCTCGATATTTTGCAA TATGCTNTTCGGTACATGGATTTATTAACGTCGTCTTGATCCCAGAAAATTTCTCTGGTGGAAATAAAATATGATTTGAA TATATATCATTCATAGATAAAGTTTCCAGTGAACATTGCGATACAATGGTATTCCAATCTTGTTCATCCATAGGAAACGG AGTTTTTTCCACAATTAAAACAGCTTGATCATTACAATTATTCACATCGAGTAGCACAAAAGTTATCTTACGGGTAGCAT CTTCGCCAAGTATTTCTTTAAATTTAAAACCTTTCAAATCATTACAACTTTTCGTATCATCAGTAATTTTAATTTCATCA GCTGCCATGATATCCATACTATCGAAGAAATAAATACAATTTACTCTTTCCCTCAAACCTCGTGCCGCATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1446: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7619901681858AA123547MBAFCE7F08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8195861763767AA180549MBAFCF7E02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11538472247061AA509184MBAFCX8C06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 21:0:54 on Sun 19 Nov 117.