CBrugiaQ_1464


Sequence

>CBrugiaQ_1464 (2 EST) Length=470 GCTGCGACATTTCAATATTGCTGTGAATGCGTTGTGGCCAAGGACAGCAATCTGGACTGTTGCGATCGAAACGAATTCGG CACCAACAGCTACATTAGCCAATTTTACAGAATTGTCGTAAGCCAACAATTATGGCAGATGCTGCATATGCGTTACTTTC TCGTGATAGCACTAATTACACCGGAAATTTTGTTATCGATGAAGAGATTTTACGGGAAGAAAGAATGAAGGATTTTGATC AATATTCCGTTAATCCAGGAGCGACATTATTAGAAGAATTCTTTCTTTCTGATGTTGCTGAAACAGCAAATTTTGGAACA GCTACCTCAATTTTGTCCTTGGATGTGTTGATAGATGAAACTAAACAACGCATCACTCCAGACATAGTACAGAAAATCCA AGCTATCTACCAATTCGATGTGATAGAAAGTCCAAAAATTCATAGCATATATTTCAATCTAAAGAATGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1464: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7620201681888AA123577MBAFCE8B01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10481722064819AA406840MBAFCZ5G04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 10:30:54 on Tue 21 Nov 117.