CBrugiaQ_1482


Sequence

>CBrugiaQ_1482 (2 EST) Length=500 ATATACGCACTTTTATTGCAAGAAAATGAAATTTTAATTCTCAACACTGAAGTAATTAAAACTGTTACAGCATATAATTT ACAAACTTATCAGAACGTGAAAATAGTGAAAGATGAAAAACTTTTAAGTGCTACCACTATGATGCAAGCATACACTGCCA TGTGTCATACAAACATTTTTTCAGTTTTAGTACATTTTCGAGAAATCACCATAACAATTTCACATTAAACGGTTCTTTCT GGTGATGTTTAGCATATTCTGTACATCGCACTTCCCAACGACCATCAACTCGAATAAAGTAGCAATATAAACATCGAAGT TTCAGCTGCTGTCGGACCTTAAAATTTGCTCGACTTTCAAACATGCCACTTTCCGGGTTCAACAAACCACGCAATATTGT TTGGCAACTTCGACATCCTGCAGCAGCGACACGACCAAGTGATAACATTCTTGCAATCTCAATGGAAAATTGATGACTTA CATACTCTCGCAAAAATGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1482: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10480882064735AA406769MBAFCZ4B08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11535922246806AA508929MBAFCW1C11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 12:45:25 on Tue 21 Nov 117.