CBrugiaQ_1486


Sequence

>CBrugiaQ_1486 (4 EST) Length=446 CTCGTGCAGATTAGATATAGTTGGAGTGTAATGAAATGTCGATGAAACTGTTGCAGGAAGCTATCAAGCTTGTGGATGCA GATGACAGAGTAAAAAATACGGAAACCGTACGAAAACCAGTAAGAGTTTCAAAGGCAGAAAGAGATCATCAGAAGCTTGC CGCTGTACTCACCACTTCAGAATACGATCCAGAATTAGATGATTTCATCGTAAATTCGAGTGTGCAGAAGCAAAATTTAA TAAACCCTAAAAGGAAGAAAATTACTAAGAACATTTCATTATTAGAAGAAAGTCGCTTAATAAACAAGACAGACCTGTTG AAACGTAACATTAAATATATGGTTTACGAAACGAATTGTAAGTTGGATCCTGATAAAACCAAGCAATTGATAGGTTTTAT GGATGAACATAATCGTCGTCAAAAAAAGATCCTTCATGCGTTGCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1486: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4425561164704N41106SWMFCA278SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8002961737679AA161649MBAFCG0B12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002981737681AA161651MBAFCG0C03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8003141737697AA161667MBAFCG0D12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 19:27:47 on Mon 20 Nov 117.