CBrugiaQ_1488


Sequence

>CBrugiaQ_1488 (2 EST) Length=464 CTTTCAAGAAAGCAAAGAAAACAGGAGGGCGCAACACTTTGTTCGAAAGGAAACTGCTGGGTCGATCTTTCACAGAGTTA CGGGGCTGTTACGTACCCAGACAATTGAAGTGGAAAGAGAGGACATTATGGCACGACGTGTATGTAGCTAATCCACCACA TACTGAAAGCTTCTACAGATACATCAATCCCCCATCAGAAAACTCTATATTACACAGGACGAAAATCGCTATGGCGCGAT CTAATAAGAAGTTCCTGCCTCATCGGGGGCTATAAGTATCACCAATCGAAGAGTTCGGGAATCACTTTAGCCCAAAAAAT TCATCCGCACCTCTTATAAGACGATCGGAAAAACGTGGCCTGAACTAAACGACGATGAGCACTATCAAAAAGCTTTGGTG ATGCTGAATAAAAAACTTATCTTGGAAAAGAAGGGAATAAGCGGACAGAAATCTTTGCAGTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1488: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217793808615R47728AS3ISB132SLBrugia malayi infective L3 JHU93SL-BmL3
12618822393078AA585666SW3D9CA421SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 2:40:54 on Sat 25 Nov 117.