CBrugiaQ_1491


Sequence

>CBrugiaQ_1491 (11 EST) Length=505 TTTNNGAGAAAAAAGTAAGTTTATTTTAAATCGCTTCAATCATAAGACTGTACTGAATATATTGCGGCCAATGAAGTTTT CTTAGTTGCATTTTTAGTAGAAATTATCCTGATCTATTTTGTGACTTAGAAAACGATTTATGCTTTAAGATTCATGTAAT CAAATTCGAAAATTAATGAGATATTGATATTACAGCATCAGTCAGTCATGTTGCAGTGCCGTGACCGTGTTTAGCAAGTT CATCTCTCAGCTGTTTGGCGAAATCATTCTCATTCGCTTCATCATCCCAGTTGTCTTCCCATACATTTAATTCCTCTTCA TCTTCAGCGCCCTCCTTAGCTTGCCAATCTTGTTGGGGAAATTCTTCAAATTCGTCATCCTCTTCAATATGTGTTTCCAT TTTCTGCTGATTACCTTCCGGCTTACTTTTGTTTTTGCCTTCTGTCATTGTGAAATCCTTCGCAGTTGTAATTTTACAAT TCAGTTCCAGTTCTCAAACTTGGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_1491: (11 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
325131951341R88405TNPIBM4002Brugia malayi infective L4 JHU93SL-BmL4
4449641172346N43463AS4SLC810T3Brugia malayi L4 JHU93SL-BmL4
5220931289165W15125RRAMCA1251SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6674961531506AA051800SWAMCA1427SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8002701737653AA161623MBAFCF7D02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8558161817219AA216503MB2SLJ1G01T3Brugia malayi second stage larvae JHU96SL-BmL2
9100981906163AA269095KJ4SLB001T3JHU93SL-BmL4 (JHU)
9164651917085AA275450MB4SLY1F07T3Brugia malayi L4 JHU93SL-BmL4
10797872140407AA435493SWAMCA1754SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11888322289696AA542784MBL2SK3E10T3Brugia malayi second stage larvae JHU96SL-BmL2
11888342289698AA542786MBL2SK3E12T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 19:26:15 on Fri 24 Nov 117.