CBrugiaQ_1494


Sequence

>CBrugiaQ_1494 (3 EST) Length=442 GGACCAGTTGGACCAAAAGGTCCTAAAGGACCTCCAGGGCCAGCTGGTGAACCTGGAATAAATGGTGCAGAAGGAAGTGA TGGAGAACCTGGTGAACAGGGACCACAAGGTAGCAGCTGGTAAGGATGGAAAATCTGGCAAANATGGCAAAACTGGAACG CCAGGTAGCACAGGTATGCCAGGACCAGATGCTCATTACTGTCCATGCCCACGACATGGAAAATATGCTTCTCGATCATA AGTTGAAATTATTTGCAAATATATCAGTCTTATCACTCTTCTGTCATTATTGGTGCTACCTTCATGTGATGATGATAAAA AATGATAATGATAGTGACTGTTGGTGTTGATGATGATAACATGATGATAACCTTTGTAATATATCACTAATGCTTTGTTA TAGAGAAAAATACCAGACTATATAAAAAATTTTCCTACTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_1494: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11939192315071AA547870MB3D6V2B05T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
12618952393091AA585679SW3D9CA442SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
13668492605387AA661343MB3D6V5H06T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 4:33:27 on Sat 25 Nov 117.