CBrugiaQ_1497


Sequence

>CBrugiaQ_1497 (2 EST) Length=461 GAAAGATATATCCAACAACTAAATACCAAGCACAATGCATATATCAACTAAAGACATGGAAAAACCAAGCACCGAAACAA GTAACCATTGCTGTACCGATTAAAGTACCATCTTTAACAGTATACCCAGATGATTTCATAGAATAGAGAAGCAAGGCGAC CAAAGTAAGAATAATCATTGTTGGTCCATACATATCATTAGAAACATGCATNTGCGACGGTTTCCGAGGTATGAAAGACT GTATCAAGCGATTTCGGACGTGACGTGGTTCCACATCAAAGTAGGGTCGAAATAAGTCGATACGACCGTAGGAAGGTAAT GTGTCTTTCATTTGCTTAGTACTTGCTTCCCAAACCATTTGAGAAAGCTTCGCATGTAGCACATCTCTAGTTGACTGTGT ATGCACTGCCAACTGAGTTTGTACGATTTCTCGACCTTGTGCTCTCCATTACCTCAAACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1497: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
320239945440R86413SWAMCA372SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6364001486165AA022383SWMFCA514SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 21:48:50 on Fri 17 Nov 117.