CBrugiaQ_15


Sequence

>CBrugiaQ_15 (10 EST) Length=861 GTTGGAAAANAAAGAACCCNTTTTTTTGGCGGTTTNGNCAGGCNTCAAGTTTTTTTTCACCNGTTCATTTCCCAGGANGC CTTAACCTTTTTCATATTCCCGGGGGGANCAAAGGGAATTCAATTTCCGGCAGGNGGCGNTAAACCATATTTTGGGGGGG GGAGTACCACCCAAAAGGGAACGGNCGCCTTTGGAGANGAATTATGGATTTTTCNCCTTTGTGGATTCGGCGGAGAGCGC GGTCAAAACTTTCCGGGTAGACCCACCTCAGAACCTTATTCCCCAAAATGAAGNTGANTTCCTTATCGTAGAAAATTGAC CATTGTATGAACCAACGGCACATACTTTAACAGTTGAACCTTCAGTAGGACTGGAATATTTCTCACCTTCTACAATGATT GATCGGGTGATTGTACCATCTCGATCTGGCGAAATATCTTCCCCTTGCCAGCTCAGTAATTCAATTTCAAATTTAAGTGT AGCACCGCCAGGAATTTTTGGTGGGCTACCATTTTCACCATAGGCATAATCGGCCCGACAAATGAGATCACATTTCTCGC CCTTTTTCATTGTCGCAACACCAAGATCCCATCCTTTGATAACCTGCCCGTTGCCCAAGGTGAAGTTGAATGGTTCATTA CGATCACGGCTCGAATCGAACTGCTCGCCATTTTCAAGAATTCCTACATAATGCACATACACACTATCACCCTTTGAAGG ACGATGTTCCCCTTTTCCTTCCACTAATATTTTTTTCAAAACACCGCCATTCTTTTCAGGAGTGATATCAGTTCCATCAA CTGCAGCCATTATAATGTGCTCTGGATCTTAACCTCAAACTTGTGCCGAATTCGGTATGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_15: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6364011486166AA022384SWMFCA516SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6364511486216AA022434SWMFCA683SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8854871876891AA246057SWMFCA1222SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8854911876895AA246087SWMFCA1228SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10751922113669AA430873RRAMCA446SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11163132199454AA471690MBAFCX5E02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11888492289713AA542801MBL2SK3H05T3Brugia malayi second stage larvae JHU96SL-BmL2
12707262405707AA592044SWAMCA1816SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
12774322429574AA598381SWMFCA2945SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12774332429575AA598382SWMFCA2946SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 12:1:26 on Mon 20 Nov 117.