CBrugiaQ_150


Sequence

>CBrugiaQ_150 (3 EST) Length=1084 GGATTCGGCAGGTAGCTGTGCTTGGCAAAGTAGTAACCGGCAGGTNGTCCTTGTGTGGTGAAGGCAGCTGCAAACATTTT GTTGGCNGATTTGGCTACTGGCTTGGCAATTGTGCTGCAAAGAGCTGCGGCTGCTGGCGGTTGCAGCAGTAGGTGCAGCA CCAACGTGAAGGCGACAGAATAATTGGTGCTCCAGTTAAACCAGGTGATCGGAGATTATTCGGGCTGTGTAGCAGCAAGA GGTAGCGGTGCCATCAGACGAGCTTGTAAAGCAGCCAATGAATTTTTGTTAACTGCAGCCGCAGCTGCAGCTTGCGCAGC AGCTGTTTGATTAACAGTTCCAGATCGATAAGTTCCATTAATGATCGCTAATTCCATCAGCTGTTTACGCTTTAGCTCAT CATCGTCTGACGAAGGCACAAGTAACTTTTTTACTTCAGCTGCAGCTCGTTTTAATTTTAACAATGCACGATTAGGTGTG TCTTCACACTGTATCAAAACATGTAACTCTTCTGATAAATGTTCCCAGTTAGGTTTTCCGCGGTTTGCTTCTTCCTTAGC TTTATCGCGCATTGAACCCTTCCCACGTACCATTATTTTACAACCAGTTCCTTGTCCAAGTTGTTCCGCTGTCAAACCAC GTGGACACAGTATCCTCCCGACAAAATTATAATCCGGATGTTCCTTCACAGGAACAAATATTTTTCCGTCATGGTGGTAA CGTCACCCTCTGGTTCTGGTAAATTTGACATTGCATCCTTTGCAAACTCGAATTGAAATAACGATACTCGAACTCTGCTG ATTTCTTCTTCAGCGAGACGATCGAGATGATGGAAAACATTAGGGAATGCTTCCAGCTGTTTCTTGTCTTTCAGTAACTG AGCCAAATATTCATACGTATACTGCGTTTTGCTACCACCGCTCAATTTCCCATTTGTTGCGGGGGCGTTTGATGATTCTG ATTGCGCATGCGGTGAGATTGGCGTGTTTGTTGAGGGTAGGTGCCCGTTTTCCATTGTTTATATGCACATATCATTCATT AATCAGGACTAGCGAATTTACAGTTTCGTTTGTCGCTGTCTCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_150: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217593808415R47528SW3ICA026SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4459631182980N44461SWMFCA183SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11919312307173AA545882SWMFCA2431SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 17:15:27 on Wed 22 Nov 117.