CBrugiaQ_1508


Sequence

>CBrugiaQ_1508 (14 EST) Length=425 GGGGGGATCTTNCTCCACCGGGGNGCCGGNTGCTCAAGAAGCGGTTTNATTACCCAAGTTTGGAGTACAAAGCCAATGTG GTATGAGCAAATTTATTCGAGTGTAATAACAGTTGCATGTGTAGTAATAACAATGCATATTATGTTACCGGTCAATTTGA TCGAGACAGGTCATGTACATCGTCGAAATATGCATGGTTACATGATTTTCCAGAACAAACGAGATTGGAACTTAACAGGC AACATGTACAAAGTCCAAGGACTTGAATCGATTCCATCCGAATCATCGTCGTCATAGATTCTTTTTGACGATTATATTCT TTTTGAGTTTGTCTACCTATGCATTCTCTATGGTTCACCAATTCATAATGTATTTTGATTATTCTAGCGTAGAAATGTTA ATAAAGTTGGATTAGTAGNTNCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1508: (14 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217675808497R47610AS3ISA058SLBrugia malayi infective L3 JHU93SL-BmL3
281227889984H21289AS3ISB157SLBrugia malayi infective L3 JHU93SL-BmL3
3644731017400H63054AS3ISB147T3Brugia malayi infective L3 JHU93SL-BmL3
4157221122665H98444KJ4SLB141T3JHU93SL-BmL4 (JHU)
5594201345241W51528AS4SLC590T3Brugia malayi L4 JHU93SL-BmL4
5594761345297W51584AS4SLC777T3Brugia malayi L4 JHU93SL-BmL4
7621011681969AA123674SW3ICA1902SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8982761892881AA257405MB4SLM2E8T3Brugia malayi L4 JHU93SL-BmL4
8982851892890AA257251MB4SLM2F6T3Brugia malayi L4 JHU93SL-BmL4
8987501893355AA257839MBL2SJ4B5T3Brugia malayi second stage larvae JHU96SL-BmL2
8987701893375AA257859MBL2SJ4D5T3Brugia malayi second stage larvae JHU96SL-BmL2
9165051917125AA275477MBL2SK1B04T3Brugia malayi second stage larvae JHU96SL-BmL2
9246711927241AA283583SW3ICA2740SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
12652102402581AA588918KJ4SLB384T3JHU93SL-BmL4 (JHU)


Date: 14:10:47 on Sat 18 Nov 117.