CBrugiaQ_1514


Sequence

>CBrugiaQ_1514 (2 EST) Length=450 TGAAGAAATCACCACCAGCATCTGATGAAATTAATATAGNCTTCACCTCTTGTTCTCNAGGTCCAACTTCGTCAAATTTC AACAAACGTCGCTTCCTCAACAATGTTGACAATGAAAATGGTGCAACAAGGGGAAAACGGTAAAGTGAAAATCAGCGACA GCCGCCCAAGTAAAATCAAAATCGCACAAATGAATAAATAAGGACCTTAATGCAAGTTATAAGGCAGAAAAATGTGCAAT CCGAATCACAGAATACAGAACTACGGTGCATCAAGAATCTGGCACAGATGTGTGCGATTATAACGAGAATCGACCTGCAC GGAATCCGACAACAATATACCAAAGTGGTGTAAGATCTCCAGTGTGCCTTGGTATATATCCCAAAAAAATGAAAATTTCT TTCCACGCTTTCAGCAACACTTACACTTTAGCGAATATTTAATACTCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CBrugiaQ_1514: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4458801182897N44378SW3ICA1216SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7092331613907AA074003SW3ICA1657SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 14:37:49 on Fri 17 Nov 117.