CBrugiaQ_1515


Sequence

>CBrugiaQ_1515 (4 EST) Length=453 CAATCTTCCGTACGACATCCATTCCTTCGATAACTCGGCCGAATACAACATGCTTACCATCCAACCAGTCCGTCTTCACA GTGCATAAGAAGAACTGAGATCCATTCGTATCTGGACCAGCATTTGCCATGGATAGCACGCCAGGTCCAGTGTGCTTCTC TTTGAAGTTTTCATCTTCAAACGTTAAACCATAAATAGATTCACCTCCTGTACCATTTCCGCGTATGAAATCACCACCCT GGCACATGAAATTTGGGATGACTCGATGGAATTTCGAACCTTTGTAATAAAGAACCTTTCCCAATATACCATAGCCTTCT TCACCCGTGCATAATGCACGGAAATTTTCTGCTGTTTTCGGCACTACATCGCTGAACAACTCCATAACGATACGACCAGA TGGATCTCCGCCAATGGTAATATCGAAGAATACGTGTGGACGAGACATACTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_1515: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8983941892999AA257269MBAFCZ1A1T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11161812199322AA471558MBAFCX3H04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13668662605404AA661360MBAFCW3A12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13813452655465AA675759MBAFCW4D10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 2:35:34 on Sat 25 Nov 117.