CBrugiaQ_1521


Sequence

>CBrugiaQ_1521 (4 EST) Length=446 GGTCGACGTGAAAATGAAGAACTGCGAACCCATCCGTAAAAATATAGAGCCTCCAAAATATGTAGAACAAGTGAAGGCAC GAGTGGTGATGCTGCAAAACCACCAATTCAACCAATTCCACTACATGTACCTAGTGCCGATGAGGTTGAGGAAGAAGAGA AAACAATTCAGGCCGCCGAAGAAAATTTGGTCGGAGAGGGTGATGATGCGGAAAAAGCGAGTGATACAAATAAGCCTAGT CGGAAAGTATCCGGCGCAGCAAGCGGTAAAGCTGCCGCACCACCACCAACGACCAAGAAGCCAGTGAAAGCAAAATGAAA TGGATCGTATCTGTCTATTTTCCTCTTCTCTCAATACAAAATTTATTACTCCCATAATTAATGTTTAAAATTATTTGCGA ATATTCGTTTGTAGCCTGAATGAACTATAAATAAAAATGTAATTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1521: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11939292315081AA547880MB3D6V2C06T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13666712605209AA661165MB3D6V3E12T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13667882605326AA661282MB3D6V5A11T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13668212605359AA661315MB3D6V5E06T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 6:6:48 on Sun 19 Nov 117.