CBrugiaQ_1524


Sequence

>CBrugiaQ_1524 (2 EST) Length=443 TATTATCGCACTTACTTGTGGATTGTTACTTGGATGGAGTATTGGTTCTGTCCTACAACAAATATTTTTCATCAGGACTG TTGAGATAATAGTGAATACAATTTTAACAGTGCTCGCAATTTGCTCGCTAATTGTTGCGGTGTCATTCTTATTGGAAAGG AGTGACTGGAGCCGTTATGAAAGTTATCGGTTGATGGTCGGAACAGCTGTCTGCTTCCTAATACAATCAATTGGTTGCAT AATGATGCTGTCTTGGGCATTTTATGGAAATCTCGTTATTGTTGAAAGCCGCTGAAGTATAATGGAAGATGGATACTAGA TGTGCAATGATTATTCCTGTGCACGTGTTATCCACAGCTCATTCATGCGTTTTTTTTTCCTTTATTTTTGTCNAAACGAA AATGATATGAAAAGTTTACCCACCAGGGAANTTNGAACCTTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1524: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
320254945455R86428SWAMCA405SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
12618612393057AA585645SW3D9CA388SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 14:24:28 on Sun 19 Nov 117.