CBrugiaQ_1525


Sequence

>CBrugiaQ_1525 (2 EST) Length=446 AGATGCCAGGCTTGTCGGAAAAGCCAATCCTAATACGACGGTCGCGGCCATCTGTTGGGCCGTTTGGCCTCGGTCATTGC CAAGCAGATCCTGAATGGCCGCAAGGTAGTGGTCGTGCGCTGCGAGGATTTGCAGCTGTCAGGACACTACTTCCGGAACA AGATAAAGTTCTTGGCCTATCTGCGCAAACGGTGCAATGTCAATCCGGCCCGTGGCCCATTCCAGTTCCGTGCCCCCAGC CGGATGCTGTGGAAAGGCCGTCCGANGAATGGTCCCACACAANACCAAGCGAAGACACAACGCCTTGAACCGCCTGAAGG TTTACAAAGGGCATCCCATCGNCGTTTNATCGCCATAAGCGTCTGTGTGTCCCAACGGCCATGAAACACTCTGCATGCGT CCCGTACAGGAACTTCTGCGATNTCGGACGNATTTGCCCATGAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1525: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7496771663681AA111791SW3ICA1885SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8865171878429AA247100SW3ICA2204SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 21:25:9 on Fri 24 Nov 117.