CBrugiaQ_153


Sequence

>CBrugiaQ_153 (2 EST) Length=722 AAGAAAATGGCTCCAAAGGGGAATAATATGATACCAAATGCACACTTTCATAAGGACTGGCAGCGTCGCGTCCGCACTTG GTTTAACCAACCAGCACGGAAAGAGCGTAGACGACGTAATCGATACAAGAAAGGTCGACTGATTGCACCTCGTCCCCGTA GCCGGTTTGTTGAGACCAGCAGTGCGTTGTCCTAGTATTCCGATATAACAAAAAGGTGAGACTGGGACGAAGATTTACCT TGGAAAGAACTGAAAGGAGCTGGCGTTTGGAAAACGAAAAGCCCGTACTATTGGCATCGCAGTGGATTACAGGCGTTACA AACCGGTCGCTGGAATCCTTGCAGCAAAATGTTCCAACGTTTTAAAGGAATACCGGTCAAAACTAATATTATTTCCCAAA AAATTAAACCCCCCCCCGAAAAGAAATAATTCAGCTGAACGAACTCCCAGTTAGCTGCGCAATTGCGTGGAAGCCCTTTT ACCCGTCANGCANGTTATTCCTCCCTGATAAAGGCCGCCAAATAACTGAAGAAAGAAAAACAATCCCAAATGTACTGTCA TTTACGTCGACCCCCGCCCGACAAACTCTAAAANGGGCCGTGAAAAGAAAGGGCGTGAAATTACCGAANAAAGTTTTGGG GGTNGGTAAACAAAAAATATTTCTGAAGAAAACAATTNGGTGTTTTTTGAATTGTTTTTTGANAAAAATTGTTACTTTTC CC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_153: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12355102369605AA585052SWMFCA2910SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12774352429577AA598384SWMFCA2949SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 12:0:52 on Wed 22 Nov 117.