CBrugiaQ_1531


Sequence

>CBrugiaQ_1531 (2 EST) Length=662 AGCAACAACTTCAAGATCAAATTCCAGTGTTTCATCATTCTTATTTTCATTGAACATCTTTGTTGTCAACGACACGAACA TACTGCGAACTTTTTCGAACAAAGCCTGTTCTGAGCCACCTAATCTGGCATTCAGCGACGAAAATTTCTTCATGAAATCA GCAATTTCGTAGAATATGCACTCGTAATCAGTTAATATTGTGTGCAACCGTCCGGCCTTGATAAGAAATTTAGCAGCACA ATGCCTATTACCCAATCTGAAGCCTACAGGTGCCCAACAAGTTTTAAGAAACTCTGCATCCACATCTGCTTCTATCAGAT TTCTGTTCACTTCTGAATGTAAAACACCCAGCTCCTCACAATTCGCCATTAGTCTCGAAGAAGTTGGATCGCGAAGCCGA AGCCATCCTGTATAGTTCCTCCTCGTGCCGAATTCGGCACGAGCTTTTCCACGTTTGCCACAGTTCTGCTACGAGTAGAT ATTGAAATTTATATCGGATTATGAAATGTATATTGAGATCATCATAATTTGTTTACTGATTTTGATTGTTTACAGGAATT GGGTTTTGACTATTTTTATTCATTGAAATATTGTTTGTTTTGTTCATTATTTCGTAATTAAATTGCAAAAATATTTAATC TGAACTTGCGTAAATTTTCATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1531: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8197431763924AA180706MBAFCG3E10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11539052247119AA509242MBAFCX9A02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 4:27:50 on Wed 22 Nov 117.