CBrugiaQ_1538


Sequence

>CBrugiaQ_1538 (3 EST) Length=894 AATATTTATTAAATGGATAAAGAAAAGTATGAATTATGGAGCCCGTAATATCGCTAGCATCACTTCCACTCAGTCATTAA ACTTATTTAATGGAATACATTTCACTGATGATTGGATGTACGAATTTCTTCCGCTCAATCACATATTACCGTTCTATTCA CCACGGCTACGTGTAACTGATATGCCAATGATGGAAAGAACGGCCAAATTTCCTTACTATGAAAACCAACACATGCAAGC GGTGTCGCTACCGTTCAAAGATTCCGAAATGCAAATGTTAATTATTTTGCCCAAAAAAACCTTTGATCTAGCAAAGTTTG AAGATAAACTTACGGGAGAGGAACTATTCAGTTATATTAGTGCACTTGACTCATCTCACGAAATTACCGTTACAATTCCA AAATTTAAGTACGAAAATCAAATATGTTTGTTAAATGGATTGAAGAGGATGGGAGTGCAATCAATGTTCCACGAATCGAA TGATTTTTCCGGCATTTTTGAGCAGCGGTTATTTACAATGGATGATATCAGAAATCATGCTTATATCAAAATTGATGAGA AAGGAATCAATAACGAAAATTCAAGTATGCCAGTAAGAAATGATATGGTAATGGATAAAGGAGAAGCATTTCGTGCTAAT CATCCCTTCCTTTATGCAATCATTGATAACCACGGGACTGTACTATGGATTGGTCGTTTCACCGGAAAAAACAGAGAAAC AATTGTCGAAAACTCGGATGACTCTATGCAATGTGAGGAAACACCGAAAAAAAAGACAAAGGTTATAACAGATACGAATG TTTGAGGAACGATTGAACAATGATAATATCATTTGATTATATCCACGCGAATTGTCTATTTTTGAAATATGATGTTGAAT AAAAAATGCATTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CBrugiaQ_1538: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8497371809188AA210659SWMFCA601SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8854761876880AA246072SWMFCA1193SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10482422064889AA406884MBAFCZ6E12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 23:22:12 on Fri 17 Nov 117.