CBrugiaQ_154


Sequence

>CBrugiaQ_154 (2 EST) Length=871 GAGGGATCACGGAATTTAATGCGTTCATTGATATGTACACTAAAAGAAACATTGCGACGCGGCAGTATTTCTTGTTTGCC GCTCAGTACCATTTGTTTGCAGCAACTCTGCCCTCGTTTTTACAATTCTGCAGCCTCTGCTTCGCCGGTCTATTTGAATA TCCCAGAAACACGAGTAACCTCATTAAGCAATGGTTTCCGGATTGCTACCGAAGATTCTCAGCTTCTCACTACTACAGTA GGTGTTTGGATCGATGCTGGTAGTCGATTTGAAAATGACAAGAATAATGGTGTTGCTCATTTTCTGGAACATATGGCTTT CAAGGGTACAATGAAACGTTCGCAGTCAGCCTTGGAGCTAGAAGTGGAAAATATGGGTGCACATTTGAATGCGTATACTT CCCGAGAGCAGACAGTGTATTATGCCAAATGCTTTTCTCAGGACGTTAGATCACGCTGTAGAAATTCTTGCCGATATACT ACGTAACAGTCAATTGAGAACTGTTGAAATCGAACGGGAGCGTGGTGTAATATTGCGTGAAATGCAAGAAATTGAACAGA ATTTGCAGGAAGGTTGTCTTTGATCATCTCCACGCTGGTGCATTTAAGGGTTACCTCACTCGCAAGAACAATACTTGGAC CCGTTGAAAATATCAAGTCATTGCAACGTGAAAATTTGAATGAAGTACATAAATGAACATTACCGAGGACCTCATATGGT ACTGGCAGCGGNAGGGGNGTTTGATCACCATAAATTGGNCCGATTTAGGCAAACAGTATTCGGAGATTTAGGTGGGNNGG GATGATAATTTCATAGGTTGATCTTGAAAGTNNGGGTGNAAGCTTTCAAGACATCCCCNATGAAAGGTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_154: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4450471182074N43609SW3ICA1175SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8674981849728AA228157SWMFCA1058SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 9:25:29 on Sun 19 Nov 117.