CBrugiaQ_1551


Sequence

>CBrugiaQ_1551 (4 EST) Length=630 TTAATAATGTTTTTGCCGTGATCTATGATCAATTCTGCAGCAGTTTTAATATCTTTTTCATCANGAATCATCATTGATTA GATCTTCAAATGAAGTAAACATCGGTTCGATCAAACATTCGCTTACTGCTGCATCAGTTTCTTTATAAACAGGATAGAAG TCTAGTATTGCTCGAACAATATTCCTAAAAACAAGTTTATTTCCTTCCCTGATTTGATGTCTGGATCGAAAATCCGATAA AATATGTGCCAAGCAACAGGAGAATAAGCCAAAATCTTTCTCATGCATACGATAATGCTGCAAAATGATATGTGCAGCAA TTTTTGTGAAATTTTCCTCCGATAGCCAACGTTGATGTAAATAATAAGCCAATTTTTCGAATGGTGCTGAACTAACTAAT ACACTGATCGTATTCAATGGAATAGATCCTTCTTTTGATAAAATACATAGAGAAGCAATAAGTTGGCGCAGCTGTTCATC ATCCANTCGTGCCGAATTCGGCACGAGTATACATACAACTACACGTACACGTATACAAACATACACAGTCTCTATCACGT ATGTATACATGTACACACGCGTGCACACACACACACACACACACACACAGATATACTAACTAATCTTACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1551: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4811821237152N74843SW3ICA1409SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
6722151537162AA051997SWAMCA1477SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8962941889974AA255371SW3ICA2407SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10989062168076AA454407MBAFCX1B12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 7:6:39 on Mon 20 Nov 117.