CBrugiaQ_156


Sequence

>CBrugiaQ_156 (2 EST) Length=683 TAAAATATTCAAATATTATTCAGGAACGGAAGCAACATACCAAACATTTTCCTGGAAAAGATTTCTTGACTANTGGNGAN TTCTGNTAAAAACCAGTTNNACATTTNTTCCCAAGTCTGNTATGNNGCTTNTTACACGCTCATAGAGTTGTTTTTTTTTT GCTGCAGTGCACAGAATTCTAGTCGGTGTCATATGTTGGTAGTAGCAGCCTCCTTTTAAATTATCAGCACATCCGAGGGC TATCGTTTCTGCTGCAGCTAAAGCTGGATTTCTCATTACAATCCATAGAAGTCGGAAAATCATGGCTTTGGTTAAAGTAT TTGCATGTTCGTACAAACCACTTGCGACACAACCGGGATGTACAGAAATGGCGGTTACCGTCCGTTGGTTTGCTGTCACA CATTTCTGCTGCATTTGTTTATTCATCTTCTCAATATAAAGAGATATCGCAAATCTCGATGTCGAGTAAGCCTGATAACC ATTCCGATATGTGTGGAACATTTTAGAGTTGTCTTGAAGCATAGAAATAAAAAACCCTAGGTGTGCGGTGGCGGAGGATA AGAACACAACACGACTGTCTCGGACACAGCTTTCTCCTGCAGAATATTTAATCATGGGCGACAACNAACAATTAACCATG ATGGCGTGGGAAAGAAGATTAACAGCGTAGTGATCTCAAAGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_156: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5014271266948N94667SWAMCA440SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
12618052393001AA585589SW3D9CA263SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 0:25:32 on Thu 23 Nov 117.