CBrugiaQ_1572


Sequence

>CBrugiaQ_1572 (2 EST) Length=443 CAAAACNGTAATATCATTTCNAAAAGTTGATTCCAAATGTAAGGATCGTACATTGACAATAACTGGTAGTAATCAAGAAT CGATTGATTATGCGAAACGTCTCATCGAGCAAACAATTCGNCGAAATATTTCACCTAATCGAACTGAAGCAAATGATGCA GAAGTTGACAATGACAATGATGATGATGATGATGATGATGATGATGTTGGGATATCAATCGAAACGACACAAGATGGCAC TTTGAAATTGTCGTGTGCTGATCCACAAGTGCTTCAGGCAGCGCAAGCAGCTCNTGAGTGAATATTTAACAAAGAGTCGG CCGAAACCATTCGCGAATATCAGCTGAAGAACGTGAACAGCGCAAAGAAAGGAGGAAAATCAAATGCCACTGCAGGCCTC ATCAAAATCGCCAAAATTGCTAACTTGTGACAACTCAACCGGN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1572: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4446151167416N43111SW3ICA946SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8001351737518AA161725MBAFCE8G07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 0:39:35 on Sat 25 Nov 117.