CBrugiaQ_1573


Sequence

>CBrugiaQ_1573 (2 EST) Length=453 GTGGATCCATACTTTCTACTGCTGGAGTTTTCCAGAGCTCATCTAAGGAATCATGCGGTACTAGATCTCCAAATGCAGCG GTAGTTTCACCGTTTTCTTCACAGATAATTTTGATCACACATAATACAATATTTGAAACAACAAACTGATAAGGCAATGC CTCCAACAAATGCTTTCTTTCAGTTTCCAGCAACTCAATGAGTTCTTGAGCACTGTTGTACTTTCCAAAACCTATGATTT TTCGAACATAAACCAAGGTATCAACTGCGATTCTGTGAGATGATACCTGCTGCATGCCATTTCTCATTCGATGTATAAAC AGACGCCGTGCGCAGTCTTGATTCACTTCTTTTTTTACTTCATAATTCTCGGTATTCTTCTTCTTCATTACATTCATTAT CCGATTACAATATATAATTTGCGTATGTTCTTGCTTCAGATACCTCAAACTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1573: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11160992199240AA471476MBAFCX2H10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13860592660421AA680473SWAMCA3062SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 17:14:44 on Wed 22 Nov 117.