CBrugiaQ_1574


Sequence

>CBrugiaQ_1574 (33 EST) Length=613 AAAAAAAACATAAAGACGATGTTTTTATTGATTACCAAGCCATGACAACATTAACATGAAAACAATCACAAACAGATCAC TGAAGCAAACACTCTTAGAACTGAATGACCTGTCCACGTGTTTTCTTTTGACCACCCAGTTCAAAATGTTTGCACCGCTT GATTGGTAACTGTTTGCGGTGCTTGCATTCCGTACATTCCATTCTTAAAACGATTTTCTTCGTTGTTTTTGCTTTTTTCC TGAAAATCGGCTTTGTTTGCCCACCAAAACCTTTCTGTTTGGAGTCATAACGTCGCCTGCCCTGTGCCAGTCTTGATTCC TTACCCTTCTTATATTGGGTTACTTTATGCATCGTATGTCGACGGCATTTTCCATCACAAAATGTTCGTCGTGTTTTCGG AACGTTCACCATTTCGATCCACCTCAAACTTCGGGACGAGCTCGTGCCGAATTCGGCACGAGGCCGATGGTACGTTGTCC TGCACTGGTTGCAAAAAAAAAAGNAAAAAAAAANAAAANAAAAAAGGNGCCNCCGAAGGGTGGANAATTTTTANAAATAA AAAANGGGGGNNTTTTGANTTAAAAGAAAAAAANGGGGGAACCCCCCCCNAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_1574: (33 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435260
1435278
1435291
1435293
4427091164857N41259SW3ICA662SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4449801172362N43479AS4SLC812T3Brugia malayi L4 JHU93SL-BmL4
4809901236227N74828RRAMCA1099SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6001191420957W91843RRAMCA198SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6363921486157AA022375SWMFCA503SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6807031547266AA054859SWMFCA808SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7271851634830AA089351SWAFCA47SKBrugia malayi adult female cDNA (SAW96MLW-BmAF)
7271901634835AA089356SWAFCA55SKBrugia malayi adult female cDNA (SAW96MLW-BmAF)
7619641681832AA123661MBAFCE7C09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7620571681925AA123634MBAFCE8E12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002821737665AA161635MBAFCG0A07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196311763812AA180620MBAFCG1B10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8557911817194AA216490AS4SLC688M13RBrugia malayi L4 JHU93SL-BmL4
8808261870810AA241492MBL2SJ0B1T3Brugia malayi second stage larvae JHU96SL-BmL2
8808321870816AA241498MBL2SJ0B7T3Brugia malayi second stage larvae JHU96SL-BmL2
8808951870879AA241561MBL2SJ0H5T3Brugia malayi second stage larvae JHU96SL-BmL2
8809211870905AA241613MBL2SJ2B10T3Brugia malayi second stage larvae JHU96SL-BmL2
8809281870912AA241620MBL2SJ2C6T3Brugia malayi second stage larvae JHU96SL-BmL2
8809441870928AA241662MBL2SJ2E6T3Brugia malayi second stage larvae JHU96SL-BmL2
8809701870954AA241649MBL2SJ8A1T3Brugia malayi second stage larvae JHU96SL-BmL2
8810801871064AA241538MBL2SJ9C11T3Brugia malayi second stage larvae JHU96SL-BmL2
8983221892927AA257451MBAFCZ0B1T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8986721893277AA257787MBL2SJ3B11T3Brugia malayi second stage larvae JHU96SL-BmL2
9164511917071AA275436MB4SLY1E05T3Brugia malayi L4 JHU93SL-BmL4
9165041917124AA275476MBL2SK1B03T3Brugia malayi second stage larvae JHU96SL-BmL2
10480872064734AA406768MBAFCZ4B07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10481442064791AA406799MBAFCZ4G10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10989232168093AA454424MBAFCX1D10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11887722289636AA542724MB4SLY2E10T3Brugia malayi L4 JHU93SL-BmL4


Date: 8:22:22 on Wed 22 Nov 117.