CBrugiaQ_1579


Sequence

>CBrugiaQ_1579 (4 EST) Length=595 GATACAGTGCGTCGACGAATGATGATGCAATCCGGTCGCAAAGAAATACTTTACACAAATACATGGGATTGTGCAAAGAA AGTTGTTGCCAACGAAGGATGCACATCACTTTACAAAGGTGCTCTTTCCAATGTCTTCCGAGGCTCAGGTGGTGCACTTG TATTACCTATTTACGATTAGATCCAAAAATATTTATAAACTGCCGGTGATAAGTCTAGGTATTTCGAATATACGGACGAC ATCTGGTTCTTTTTATCACATTCACCATATGATGGGATTCACTATCAGCTATAATTACATTCAAGCAGTGCTCCGTTTAT CGTACATAATGTTTTTTACTCTTGTCATGTCTAATTACTTGTACTTCATCTCACAACTTAGGATTCGGAAACTGATCAAA ATAGTGCATTGTGTGGGATGTGAGCAATTTAACATTATTTGTTCTTTAATTTCACTTCCCAGTAGGATACCTCATTATGT TCATTTATTCTCCAGCTATTTTTCTATATGTTGTTGCTAGGTTAGCCATATATGGCAGAGCTCAGACTCGTTTATTATGC GTTTCTCATAATTTTGATAAACATTGTAAGACAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1579: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7473381660948AA109452MBAFCE2E08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11888212289685AA542773MBL2SK3C12T3Brugia malayi second stage larvae JHU96SL-BmL2
12945062435390AA601765SWMFCA3003SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
13667842605322AA661278MB3D6V5A06T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 23:16:23 on Fri 17 Nov 117.