CBrugiaQ_1580


Sequence

>CBrugiaQ_1580 (5 EST) Length=326 ATTATTTTTAATTTTCGATTAAAAGATTATATATTATAGATAGATTTTATTTAGTCTTCTAAACTATTTTTGGGTTTTAC TCGTCTATTTTTATTATTTTTTGTTTTTTTTTTAATNTNGTTTTAAATTTTAATNAATTTTGGTNTNTGGGACTATATGG TTNNATGNAAATTTTTGGTAACCNGCACTTTGGTTTTGGTTTTTTAAACAATGGGTGGTGGTAAAACTCCTGGTTNANTT AATTATNATNTTATCCAGGAGGTTGGTGGTNATAATTTTTGGGTTTTGNATATTGGGAAATTCCANTTTTTTTTCCTAAT ATNNAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_1580: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6722441537191AA052013SWMFCA717SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6838421550601AA057948SWMFCA971SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8675351849765AA228207SWMFCA1135SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11253292209397AA480699SWMFCA2046SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12212572344751AA570861SWMFCA2626SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 13:2:17 on Sun 19 Nov 117.