CBrugiaQ_1581


Sequence

>CBrugiaQ_1581 (2 EST) Length=444 AGAGATATACATTATTCTAACCACAGTTTTATAGCGTGACGATGTTTTATTCTTTTATTTTTGATTACTCATGAATTCAC TGTATAAATTCATTCGTTCCCACTTCACCAAGAAGGTGCGAACTTTCATTTCAAGTTTTTCAATATATGGTTCACCAATT TCCGCAAAAATTCTATATTCCGTACCATATATGCGCTTATTTCCATCATTGCGTGTATTTAATAACATGCTTCACCGTCC CTTTTTGGTAAAACTTTCCAATAATCGTTTCCATTAACTTGTTCCCTTGGATATAAACATAAGGAGTTTTTTGTTGTTAG CGATGTTGAAACAACAAAATATTGGGAGGGAAAAATACAATGCAGTAAAAATATTTCATCCCTGTGTTATCGATTATTTG TCGCTACCCTTTATGACATTCAATTATGCAGCTCAAACTTGGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1581: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5594981345319W51606AS4SL880T3Brugia malayi L4 JHU93SL-BmL4
6676221537102AA051935SWMFCA706SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 15:12:24 on Wed 22 Nov 117.