CBrugiaQ_1584


Sequence

>CBrugiaQ_1584 (2 EST) Length=441 CAAGTTTGACACATAAAAGATGTCATCTTTTCTCGCTGTACCACTGAAACATACGAACGAGGTGGACTTGGTAAAACCTT TAATGAATTATGTCGAGAATATTTATTTGGCATCAAGTGAATTAAGCTCAGAAATCAGAGAAGCGATGCAAGAACTGAAC AAGATGCGAAACAAAGCTTGCAACCAACCTTTGGATAAACATCAAAATGTCTCTGGATGTCCTGACTAGATATTACGATC AGTTGGTGGCCATCGAAAACAAAATACCAATCACTGCCACTCAAAATCCTATCAGCTTTAAGTGGAAGGATGCCTTTGAT AAAGGTTCACTCTTTTTCGGCCGAGCTTCACTGACCTTAAGTGATGGCGCATTTGAAAGAGTTGCTGTNTTATTCAATTG TGGCGCTCTGATGTCTTCAATTGCTGCTTCTCAATCAATGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1584: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7619671681835AA123511MBAFCE7D02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11537462246960AA509083MBAFCX7A11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 19:12:35 on Thu 23 Nov 117.