CBrugiaQ_1587


Sequence

>CBrugiaQ_1587 (6 EST) Length=605 TGCAAAGTGTACGTTTCTCGAAGCCGAAGTGAACGTGTGTACGACAGGTGTTACGTCAGATTAAGTGTATGTATTCCGGA TGGAACATATGATTTGTATGTAGATATATGTGGATGTGCCACAGGATTCTATGTTTCGTTCCATCGATCGCACGTGTACG TTTCATTCGGTGGGAACATACCGCTGTTAGCAGCAGAGGAAGAGGTCTTGGGAATTTACATGAAGAAGTGAACAGACGGT TCACACAGCGAATCGTGAAAAGATTACATCGATGGGATGGAATAAGTGAAAATGAGTGGTTCATGATCTACCGCGATAAT TATGCCTCACGTTTTGTTTTACTAGTTACCCTGGCGGTACCCTTGATTGGCTTTTTGACATCCGAGAATTGTGTGGCTAA CGTGAAAAGGGGCCGACTATGGAATGCTGTCAAAGATACTAACATAGTTCAGCAGATGGGTGTTCTTGTTGTACTGCCGA TATTTTCGTTTTTGGTGGTCATGTATTTGGCATGGCATCTGAATGCCATAAGAATTCATCGTATGTATATCAGTACAAAA GACCACAAATTGTTTTTCGCCGTCATCTCTCACTATGGGATATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1587: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4811961237166N74857SW3ICA1435SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8985961893201AA257439MBAFCZ3C8T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11538732247087AA509210MBAFCX8F04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12617252392921AA585509SW3D9CA056SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
13668562605394AA661350MBAFCW3A01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13813732655493AA675787MBAFCW4G08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 12:4:48 on Fri 24 Nov 117.